Assessment of the proliferative and angiogenic effects of the synthetic cannabinoid (R)-5-fluoro ADB on human cerebral microvascular endothelial cells.

Objectives: The process of vascular formation, also known as angiogenesis, primarily relies on endothelial cell proliferation, migration, and invasion. In recent years, it has been discovered that synthetic cannabinoids (SCs) may potentially impact angiogenic processes within the body. We evaluated the impact of the synthetic cannabinoid (R)-5-Fluoro-ADB on the proliferation rate and angiogenesis in Human Cerebral Microvascular Endothelial Cells (hBMECs). Materials and Methods: hBMECs were treated with (R)-5-Fluoro-ADB and investigated for cell viability, migration rate, and tube-like structure formation. Furthermore, angiogenic-related proteins including Angopoitein-1 and -2, and Vascular Endothelial Growth Factors (VEGF) were examined on mRNA and protein levels. Results: The results showed a notable rise in the rate of proliferation (P-value<0.0001) of HBMECs induced by (R)-5-Fluoro-ADB. The angiogenic capacity of HBMECs was also enhanced between 0.001 µM to 1 µM (R)-5-Fluoro-ADB. Moreover, an increase in the levels of ANG-1, ANG-2, and VEGF mRNA and protein, as well as elevated phosphorylation rate of GSK-3ß, were observed across various concentrations of (R)-5-Fluoro-ADB. Conclusion: Our results suggest an innovative approach in pharmacology for addressing a range of conditions linked to angiogenesis. This approach involves precise targeting of both cannabinoid receptors type-1 and -2. To achieve this, specific agonists or antagonists of these receptors could be employed based on the particular characteristics of the diseases in question.

The synthetic cannabinoid 5-fluoro ABICA upregulates angiogenic markers and stimulates tube formation in human brain microvascular endothelial cells.

Objective: Synthetic cannabinoids (SCs), a class of psychoactive compounds emulating the effects of natural cannabis, have prompted addiction and psychosis concerns. However, recent research has suggested potential pharmacological applications, particularly in brain angiogenesis-an essential physiological process for growth, repair, and tissue maintenance, in which new blood vasculature is formed from existing vasculature. This study explored the in vitro ability of the SC 5-fluoro ABICA to enhance new blood formation processes in human brain microvascular endothelial cells (HBMECs). Methods: HBMECs were treated with various concentrations of 5-fluoro ABICA (1 µM, 0.1 µM, 0.01 µM, 0.001 µM, and 0.0001 µM). A comprehensive analysis was conducted, including MTT assays indicating cell viability, wound healing assays indicating migration ability, and tube formation assays indicating the angiogenesis potential of endothelial cells. Additionally, mRNA expression and protein levels of specific pro-angiogenic factors were measured, and the phosphorylation levels of glycogen synthase kinase-3ß were detected in treated HBMECs through ELISA, real-time PCR, and western blotting. Results: Treatment with 5-fluoro ABICA effectively stimulated proliferation, migration, and tube formation in HBMECs in a dose-dependent manner; markedly increased the expression of pro-angiogenic factors; and upregulated levels of phosphorylated-GSK-3ß. Conclusion: Our findings demonstrate that 5-fluoro ABICA stimulates angiogenesis in endothelial cells, thus potentially offering therapeutic options for diseases associated with angiogenesis. However, further research is needed to fully understand the molecular mechanism of 5-fluoro ABICA in angiogenesis, including ethical considerations regarding its use in medical research.

The controversy of SARS-CoV-2 integration into the human genome.

Bat borne disease have attracted many researchers for years. The ability of the bat to host several exogenous viruses has been a focal point in research lately. The latest pandemic shifted the focus of scholars towards understanding the difference in response to viral infection between humans and bats. In a way to understand the basis of the interaction and behaviour between SARS-CoV-2 and the environment, a conflict between different researchers across the globe arose. This conflict asked many questions about the truth of virus-host integration, whether an interaction between RNA viruses and human genomes has ever been reported, the possible route and mechanism that could lead to genomic integration of viral sequences and the methods used to detect integration. This article highlights those questions and will discuss the diverse opinions of the controversy and provide examples on reported integration mechanisms and possible detection techniques.

Genomic and biological variation in bat IFNs: An antiviral treatment approach.

Bat-borne viruses have attracted considerable research, especially in relation to the Covid-19 pandemic. Although bats can carry multiple zoonotic viruses that are lethal to many mammalian species, they appear to be asymptomatic to viral infection despite the high viral loads contained in their bodies. There are several differences between bats and other mammals. One of the major differences between bats and other mammals is the bats' ability to fly, which is believed to have induced evolutionary changes. It may have also favoured them as suitable hosts for viruses. This is related to their tolerance to viral infection. Innate immunity is the first line of defence against viral infection, but bats have metamorphosed the type of responses induced by innate immunity factors such as interferons. The expression patterns of interferons differ, as do those of interferon-related genes such as interferon regulatory factors and interferon-stimulated genes that contribute to the antiviral response of infected cells. In addition, the signalling pathways related to viral infection and immune responses have been subject to evolutionary changes, including mutations compared to their homologues in other mammals and gene selection. This article discusses the differences in the interferon-mediated antiviral response in bats compared to that of other mammals and how these differences are correlated to viral tolerance in bats. The effect of bat interferons related genes on human antiviral response against bat-borne viruses is also discussed.

Effect of MEF2A and SLC22A3-LPAL2-LPA gene polymorphisms on warfarin sensitivity and responsiveness in Jordanian cardiovascular patients.

AIMS: This study aims to investigate the influence of MEF2A and SLC22A3-LPAL2-LPA polymorphisms on cardiovascular disease susceptibility and responsiveness to warfarin medication in Jordanian patients, during the initiation and maintenance phases of treatment. BACKGROUNDS: Several candidate genes have been reported to be involved in warfarin metabolism and studying such genes may help in finding an accurate way to determine the needed warfarin dose to lower the risk of adverse drug effects, resulting in more safe anticoagulant therapy. METHODS: The study population included 212 cardiovascular patients and 213 healthy controls. Genotyping of MEF2A and SLC22A3-LPAL2-LPA polymorphisms was conducted to examine their effects on warfarin efficiency and cardiovascular disease susceptibility using PCR-based methods. RESULTS: One SNP (SLC22A3-LPAL2-LPA rs10455872) has been associated with cardiovascular disease in the Jordanian population, whereas the other SNPs in the MEF2A gene and SLC22A3-LPAL2-LPA gene cluster did not have any significant differences between cardiovascular patients and healthy individuals. Moreover, SLC22A3-LPAL2-LPA rs10455872 was correlated with moderate warfarin sensitivity, the other SNPs examined in the current study have not shown any significant associations with warfarin sensitivity and responsiveness. CONCLUSION: Our data refer to a lack of correlation between the MEF2A polymorphism and the efficacy of warfarin treatment in both phases of treatment, the initiation, and maintenance phases. However, only rs10455872 SNP was associated with sensitivity to warfarin during the initiation phase. Furthermore, rs3125050 has been found to be associated with the international normalized number treatment outcomes in the maintenance phase.

The synthetic cannabinoid 5F-MDMB-PICA enhances the metabolic activity and angiogenesis in human brain microvascular endothelial cells by upregulation of VEGF, ANG-1, and ANG-2.

Brain angiogenesis, the formation of new blood vessels from existing brain vasculature, has been previously associated with neural plasticity and addictive behaviors related to substances. Synthetic cannabinoids (SCs) have become increasingly popular due to their ability to mimic the effects of cannabis, offering high potency and easy accessibility. In the current study, we reveal that the SC 5F-MDMB-PICA, the most common SC in the United States in 2019, increases cell metabolic activity and promotes angiogenesis in human brain microvascular endothelial cells (HBMECs). First, we performed an MTT assay to evaluate the effects of 5F-MDMB-PICA treatment at various concentrations (0.0001 µM, 0.001 µM, 0.01 µM, 0.1 µM, and 1 µM) on HBMECs metabolic activity. The results demonstrated higher concentrations of the SC improved cell metabolic activity. Furthermore, 5F-MDMB-PICA treatment enhanced tube formation and migration of HBMECs in a dosage-dependent manner. Additionally, the mRNA, secreted protein, and intracellular protein levels of vascular endothelial growth factor, angiopoietin-1, and angiopoietin-2, which are involved in the regulation of angiogenesis, as well as the protein levels of cannabinoid receptor type-1, were all increased following treatment with 5F-MDMB-PICA. Notably, the phosphorylation levels at Serine 9 residue of glycogen synthase kinase-3ß were also increased in the 5F-MDMB-PICA treated HBMECs. Collectively, our findings demonstrate that 5F-MDMB-PICA can enhance angiogenesis in HBMECs, suggesting the significant role of angiogenesis in the response to SCs. Manipulating this interaction may pave the way for innovative treatments targeting SC addiction and angiogenesis-related conditions.

Assessment of the Impact of Lower Urinary Tract Dysfunction on Quality of Life in Multiple Sclerosis Patients in Saudi Arabia-A Cross-Sectional Study.

BACKGROUND: Lower urinary tract dysfunction (LUTD) is caused by neurogenic factors that could lead to permanent injury in affected patients, and therefore result in substantial annual healthcare expenses. LUTD is very prevalent in multiple sclerosis (MS) patients and has a drastic impact on their quality of life (QOL). This study aimed to assess the effect of LUTD on the QOL of Saudi MS patients. METHODS: A cross-sectional study was carried out in Saudi Arabia using a self-administered questionnaire that included the World Health Organization Quality of Life (WHOQOL-BREF) and LURN Symptom Index (LURN SI-29). Data were analyzed and presented as frequencies and percentages. RESULTS: There were 428 patients who participated in this study; 270 were females and 158 were males. Most of the patients received a low score in all sections of the LURN part of the questionnaire. The highest scores (urgent need to urinate and excessive urination at night) were recorded in the urgency domain (47.20 ± 36.88) rather than the nocturia domain (44.74 ± 32.91). Meanwhile, the lowest score (complete control of bladder) was recorded in the incontinence domain (22.80 ± 26.80). For the WHOQOL-BREF score, the highest score (more social stability) was in the social domain (65.07 ± 21.16 for females, 60.41 ± 21.54 for males), and the lowest score (less psychological stability) was in the psychological domain (46.36 ± 9.84 for females, 46.20 ± 10.03 for males). However, there was no significant association between the four domains of the WHOQOL-BREF and the gender of the MS patients. CONCLUSIONS: LUTD is significantly associated with a lowered quality of life. Therefore, patients are recommended to consult with and be evaluated by appropriately experienced healthcare providers and clinicians. This ensures that the patients receive the best advice, accurate and effective treatment, and long-term analysis that can lead to an improvement in their quality of life.

MDMB-FUBINACA Influences Brain Angiogenesis and the Expression of VEGF, ANG-1, and ANG-2.

AIM: This study aims to explore the impact of the synthetic cannabinoid methyl 2-(1-(4- fluorobenzyl)-1H-indazole-3-carboxamido)-3,3-dimethylbutanoate (MDMB-FUBINACA) on the angiogenesis process in human brain microvascular endothelial cells. BACKGROUND: Synthetic cannabinoids (SCs) are substances that mimic the natural components found in the cannabis plant. SCs are considered prohibited substances that have a clear impact on the central nervous system (CNS). OBJECTIVES: The purpose of this study is to explore how MDMB-FUBINACA influences angiogenesis in human brain microvascular endothelial cells and to clarify the pathways related to the cannabinoid receptors. METHODS: Human brain microvascular endothelial cells (hBMECs) were grown in the medium containing Dulbecco Modified Eagle Medium (DMEM/F12) using an endothelial cell growth kit. Endothelial cell viability was evaluated using the MTT test. Migration ability was measured using the Wound healing test. The angiogenic capability was measured using a Tube Formation assay. Real-time polymerase chain reaction (RT-PCR) was utilized to explore the mRNA concentrations following MDMBFUBINACA treatment. ELISA and Western blotting were also employed to measure the protein levels. RESULTS: MDMB-FUBINACA greatly increases tube formation, endothelial cell proliferation, and migration. Pro-angiogenic factors such as angiopoietins 1 and 2 (ANG-1 and 2) and vascular endothelial growth factor (VEGF) were shown to be increased at both the RNA and protein levels. CONCLUSION: MDMB-FUBINACA induces the progression of the angiogenesis process by inducing the expression of pro-angiogenic factors. These findings aim toward developing novel treatments for angiogenesis- related disorders.

The impact of IDH and NAT2 gene polymorphisms in acute myeloid leukemia risk and overall survival in an Arab population: A case-control study.

Acute myeloid leukemia (AML) is a malignancy of the myeloid cells due to the clonal and malignant proliferation of blast cells. The etiology of AML is complex and involves environmental and genetic factors. Such genetic aberrations include FLT3, DNMT3, IDH1, IDH2, NAT2, and WT. In this study, we analyzed the relationship between five, not previously studied in any Arab population, single nucleotide polymorphisms (SNPs) and the risk and overall survival of AML in Jordanian patients. The SNPs are NAT2 (rs1799930 and rs1799931), IDH1 (rs121913500), and IDH2 (rs121913502 and rs1057519736). A total number of 30 AML patients and 225 healthy controls were included in this study. Females comprised 50% (n = 15) and 65.3% (n = 147) of patients and controls, respectively. For AML patients (case group) Genomic DNA was extracted from formalin-fixed paraffin-embedded tissues and from peripheral blood samples for the control subjects group. Genotyping of the genetic polymorphisms was conducted using a sequencing protocol. Our study indicates that NAT2 rs1799930 SNP had a statistically significant difference in genotype frequency between cases and controls (p = 0.023) while IDH mutations did not correlate with the risk and survival of AML in the Jordanian population. These results were also similar in the TCGA-LAML cohorts with the notable exception of the rare NAT2 mutation. A larger cohort study is needed to further investigate our results.

The expression analyses of GSK3B, VEGF, ANG1, and ANG2 in human brain microvascular endothelial cells treated with the synthetic cannabinoid XLR-11.

The endocannabinoid system receptors, cannabinoid receptors type-1 (CBR-1) and -2 (CBR-2), are implicated in several behavioral and cognitive processes. Many studies have indicated a correlation between cannabinoid receptors and angiogenesis. The current study aims to reveal the possible molecular signaling involved in brain angiogenesis induced by the activation of CBR-1 and CBR-2. We investigated whether the synthetic cannabinoid XLR-11, an agonist of CBR-1 and CBR-2, influences the mRNA and protein expression of vascular endothelial growth factor (VEGF), angiopoietin-1 (ANG1) and -2 (ANG2) in human brain microvascular endothelial cells (hBMVEs). Furthermore, we determined the phosphorylation of glycogen synthase kinase 3 beta (GSK3B) expression. Treatment of hBMVEs cells with XLR-11 elevated the mRNA levels of VEGF, ANG1, and ANG2. The secretion of these proangiogenic factors was increased in the media. Furthermore, the intracellular expression of VEGF, ANG1, ANG2, and GSK3B was significantly increased. This current research provides a new possible approach by targeting the cannabinoid receptors to control and regulate brain angiogenesis for treating a variety of angiogenesis-related diseases. This could be achived by using different agonists or antagonists of the cannabinoid receptors based on the nature of the diseases.

Integrative analysis of gene expression and DNA methylation to identify biomarkers of non-genital warts induced by low-risk human papillomaviruses infection.

Background: Human papillomaviruses have been shown to dysregulate the gene expression and DNA methylation profiles of their host cells over the course of infection. However, there is a lack of information on the impact of low-risk HPV infection and wart formation on host cell's expression and methylation patterns. Therefore, the objective of this study is to analyse the genome and methylome of common warts using an integrative approach. Methods: In the present study, gene expression (GSE136347) and methylation (GSE213888) datasets of common warts were obtained from the GEO database. Identification of the differentially expressed and differentially methylated genes was carried out using the RnBeads R package and the edgeR Bioconductor package. Next, functional annotation of the identified genes was obtained using the Database for Annotation, Visualization, and Integrated Discovery (DAVID). Network construction and analyses of the gene-gene, protein-protein, and signaling interactions of the differentially expressed and differentially methylated genes was performed using the GeneMANIA web interface, the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database, and the Signaling Network Open Resource 2.0 (SIGNOR 2.0), respectively. Lastly, significant hub genes were identified using the Cytoscape application CytoHubba. Results: A total of 276 genes were identified as differentially expressed and differentially methylated in common warts, with 52% being upregulated and hypermethylated. Functional enrichment analysis identified extracellular components as the most enriched annotations, while network analyses identified ELN, ITGB1, TIMP1, MMP2, LGALS3, COL1A1 and ANPEP as significant hub genes. Conclusions: To the best knowledge of the authors, this is the first integrative study to be carried out on non-genital warts induced by low-risk HPV types. Future studies are required to re-validate the findings in larger populations using alternative approaches.

Rodent-borne viruses in the region of Middle East.

Rodents are one of the most abundant mammal species in the world. They form more than two-fifth of all mammal species and there are approximately 4600 existing rodent species. Rodents are capable of transmitting deadly diseases, especially those that are caused by viruses. Viruses and their consequences have plagued the world for the last two centuries, three pandemics occurred during the last century only. The Middle East is situated at the crossroads of Africa and Asia, along with the Mediterranean Sea and the Indian Ocean, its geographic importance is gained through the diversity of topographies, biosphere, as well as climate aspects that make the region vulnerable to host emerging diseases. Refugee crises also play a major role in expected epidemic outbreaks in the region. Public health has always been the most important priority, and our aim in this review is to raise awareness among public health organisations across the Middle East about the dangers of rodent borne diseases that have been reported or are suspected to be found in the region.

Genotoxicity of nedaplatin in cultured lymphocytes: modulation by vitamin E.

Nedaplatin is a chemotherapeutic agent used widely in cancer therapy. Nedaplatin has been shown to cause DNA damage to cells via the induction of oxidative stress. Vitamin E (Vit E) has an anti-mutagenic activity that can protect cells from DNA damaging agents. The objective of this study is to examine the genotoxic and cytotoxic effects of nedaplatin in human cultured lymphocytes. In addition, modulation of such effects by Vit E was also examined. The frequencies of sister chromatid exchange (SCE) and chromosomal aberrations (CAs) were used as an indicator for genotoxicity. The mitotic and proliferative indices were used to examine the cytotoxic effects of nedaplatin. The results showed that nedaplatin significantly elevated SCE and CA frequencies in human lymphocytes (p Ë‚ 0.01). The increases in the frequencies of SCE and CA caused by nedaplatin were lowered by pretreatment treatment with Vit E (p < 0.05). Nedaplatin significantly lowered mitotic index but Vit E pretreatment did not modulate this effect. These results suggest that Vit E has the potential to ameliorate the genotoxicity of nedaplatin in cultured lymphocytes.

Reduction of Genotoxicity of Carbamazepine to Human Lymphocytes by Pre-treatment with Vitamin B12.

BACKGROUND: Carbamazepine (CBZ) is widely used as an anti-epileptic drug. Vitamin B12 has been shown to protect against DNA damage caused by several mutagenic agents. OBJECTIVE: This study aimed to investigate the effect of vitamin B12 on CBZ-induced genotoxicity in cultured human lymphocytes. METHODS: Sister chromatid exchanges (SCEs) and chromosomal aberrations (CAs) genotoxic assays were utilized to achieve the study objective. RESULTS: The results showed significantly higher frequencies of CAs and SCEs in the CBZ-treated cultures (12 µg/mL) compared to the control group (P<0.01). The genotoxic effects of CBZ were reduced by pre-treatment of cultures with vitamin B12 (13.5µg/ml, P<0.05). Neither CBZ nor vitamin B-12 showed any effects on mitotic and proliferative indices. CONCLUSION: CBZ is genotoxic to lymphocyte cells, and this genotoxicity can be reduced by vitamin B12.

Network analysis of long non-coding RNA expression profiles in common warts.

Background: Long non-coding RNAs (lncRNAs) have been the subject of considerable attention in recent years due to their role in gene regulation. However, the function of lncRNAs remains poorly understood, especially in the context of infection with low-risk human papillomaviruses (HPVs). To further understanding on this issue, we investigated lncRNA expression in HPV-induced common warts. Methods: A publicly available high-throughput sequencing dataset for common warts was downloaded from the Gene Expression Omnibus (GEO). lncRNA profiles were generated using the NetworkAnalyst 3.0 workflow, and a list of differentially expressed (DE) lncRNAs in common warts was identified and inputted into the ENCODE, RegNetwork, DisGeNet, and miRNet platforms. Results: A total of 54 lncRNAs were revealed to be significantly dysregulated in common warts. Of these 54 lncRNAs, 24 and 30 were upregulated and downregulated, respectively. The most significantly differentially expressed lncRNAs in common warts included the CERNA2, LINC02159, SH3PXD2A-AS1, and UNC5B-AS1 genes. Conclusion: The current findings suggest that HPV-induced warts impact the host lncRNA transcriptome. To the best of our knowledge, the present study is the first to explore the impact of low-risk HPV infection on lncRNA expression profiles.

Genetic association of IL2RA, IL17RA, IL23R, and IL31RA single nucleotide polymorphisms with alopecia areata.

The signalling of cytokine receptors plays a crucial role in regulating tolerance and immunity. Impaired immunological processes result in autoimmune inflammation that target the hair follicles, causing many hair disorders, mainly alopecia areata (AA). Therefore, polymorphisms in cytokine receptor genes are suggested to have a significant impact on the pathogenesis of AA, a disease with a multifactorial basis and uncertain etiology. In the present study, 152 AA patients of the Jordanian population were investigated for their genetic susceptibility to develop AA compared to 150 control subjects. Genomic DNA extraction and genotyping had conducted for IL17RA (rs879575, rs2229151, and rs4819554), IL2RA (rs3118470), IL23R (rs10889677), and IL31RA (rs161704) using the Sequenom MassARRAY® system. The allele frequency of IL17RA rs879575 is significantly higher in patients, while no statistical differences were found for IL2RA, IL23R, and IL31RA SNPs. Also, the recessive model of IL31RA rs161704 showing that AA genotype is significantly associated with AA development. To date, there is no published data regarding the association between AA and the selected genetic variants in our population. However, this study's findings assert that SNPs of IL17RA and IL31RA are linked to AA susceptibility in Jordanian patients.

Pathological, molecular, and serological study of small ruminant lentiviruses in Jordan.

Background and Aim: Maedi-visna is a chronic viral disease of sheep with worldwide distribution causing substantial economic losses to the small ruminant industry. Pneumonia and mastitis are the main manifestations of the disease. This study aimed to investigate the occurrence of maedi-visna virus (MVV) in sheep using histopathology and nested polymerase chain reaction (PCR) techniques and also to estimate the seroprevalence of small ruminant lentiviruses (SRLVs) in sheep and goats using commercially available enzyme-linked immunosorbent assay (ELISA). Materials and Methods: Lung tissue samples from 380 sheep were collected and fixed in 10% formalin for histopathology and molecular diagnosis of MVV. Separately, 806 serum samples were randomly collected from 633 sheep and 173 goats to detect the seroprevalence of SRLVs using ELISA. Results: The results showed that 4.7% of lung samples (n=190) were positive by both histopathology and nested PCR, 5.8% (n = 380) were positive by histopathology only (have lymphoid follicular hyperplasia), and 7.4% (n = 190) were positive by nested PCR only. Statistical analysis revealed a moderate agreement between the two tests (Kappa=0.451, n = 190). Serology results revealed that sheep and/or goats herd prevalence was 59.8% (n = 87), while individual seroprevalence in sheep (40.1%, n = 633) was significantly higher than that in the other six countries and also significantly higher than that in goats (18.5%, n = 173) (at p < 0.05). Conclusion: The moderate statistical agreement between nested PCR and histopathological diagnosis of MVV in formalin-fixed paraffin-embedded sheep lung tissue samples (Kappa=0.451, n = 190) suggests combining both tests for more sensitive MVV detection in sheep lung samples. SRLVs seropositivity in sheep was significantly higher than in goats, thus, it is of high concern and urges the inquiry into the economic impact of the disease and the financial benefit of adopting eradication measures.

Warfarin pharmacogenomics in African populations: the importance of ethnicity-based algorithms.

Tweetable abstract It is well accepted that pharmacogenomics (PGx) information from Asia and Europe should not be applied to Africa. More work is needed on different ethnic groups to generate population-specific algorithms that can be used effectively and safely.

Association of TLR9-1237T>C; rs5743836 polymorphism with increased risk of Hodgkin's lymphoma: A case-control study.

Mature B-cell neoplasms are typically divided into Hodgkin and Non-Hodgkin Lymphomas. Hodgkin Lymphoma is characterized by the neoplastic Reed-Sternberg cells, usually harbored in an inflammatory background, with a frequent clinical presentation of mediastinal lymphadenopathy. Many studies link between autoimmunity and lymphomagenesis, a large proportion of these studies evidently trace the pathogenesis back to the misdirected detection of self-derived nucleic acids by Toll-Like Receptors (TLRs), especially those of the intracellular type. In this study, we analyzed the relationship between a selected SNP in TLR9 (TLR9-1237T>C; rs5743836) and the risk and overall survival of HL patients in a Jordanian Arab population. A total of 374 subjects; 136 cases of Hodgkin lymphoma and 238 matched healthy controls were incorporated in this study. Genomic DNA was extracted from formalin-fixed paraffin-embedded tissues. Genotyping of the genetic polymorphisms was conducted using a sequencing protocol. The results show a statistically significant higher distribution of the rs5743836 (TLR9-1237T>C) allele among the case population, with a p-value of 0.031 (<0.05). This distribution proved significant when studied in the codominant (only significant in the T/C genotype, p-value = 0.030), dominant (p-value = 0.025), and overdominant (p-value = 0.035) models. None of the models showed any statistically significant difference in survival associated with the rs5743836 (TLR9-1237T>C) SNP.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.